circad | circRNAs associated with diseases

circ-BCRC-3
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	30285878
Experimental Method
Sample Type	Tissues	Comparison	47 BC tissues and their adjacent normal bladder tissues were obtained from patients who underwent radical cystectomy for urothelial carcinomas of bladder
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTCAGGAGGGCAGCAGTAGA Reverse AACTCAATAGCCATTTCACCAC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Xie, F, Li, Y, Wang, M, Huang, C, Tao, D, Zheng, F, Zhang, H, Zeng, F, Xiao, X, Jiang, G (2018). Circular RNA BCRC-3 suppresses bladder cancer proliferation through miR-182-5p/p27 axis. Mol. Cancer, 17, 1:144.